The incidence of lumbar disc herniation (LDH) is increasing annually worldwide, which is likely attributable to a more sedentary lifestyle and inappropriate sitting postures. LDH is a chronic intractable disease that causes significant pain [1]. The pathogenesis of LDH is complex, with the basic pathological factors associated with the protrusion of nucleus pulposus (NP) tissue from a rupture in the posterior or spinal canal resulting in stimulation or compression of the adjacent spinal nerve root or dorsal root ganglion (DRG) [2]. Moreover, NP contains a variety of proinflammatory cytokines and monoamines that can cause painful radiculopathy and various pathological changes [3-5]. The autoimmune inflammation induced by autologous NP and inflammation caused by postoperative residual NP are the key factors causing pathophysiological changes in DRG [6,7]. DRG is considered an ideal target for neuromodulation, and given somatic tissue selectivity, the unique membrane characteristics, and accessibility and location consistency, DRG stimulation is a feasible choice for the treatment of chronic refractory neuropathic pain [8].

Mitogen-activated protein kinase (MAPK), found in several mammals, plays an important role in intracellular signal transduction [9]. The MAPK pathway mediates cellular response to external stimuli and plays a critical role in inducting cell proliferation, differentiation, and apoptosis [10]. The p38 MAPK pathway is an important signal pathway involved in neuropathic pain [11]. The activation of p38 MAPK plays an important role in the generation and maintenance of neuropathic pain by regulating cell transcription, protein synthesis, and receptor expression [12]. In addition, activation of p38 MAPK triggers the target protein nuclear factor-kappa B (NF-κB), thereby promoting the production of cytokines and inflammatory factors [13]. Studies have shown that p38 MAPK, nuclear factor-kappa B (NF-κB), and proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α, play important roles in the induction and maintenance of LDH neuropathic pain [14,15].

Electroacupuncture (EA), which combines acupuncture and electric stimulation, is widely used as a clinical pain management technique [16]. Previous studies have shown that EA relieves pain and improves physical and psychological health of patients with LDH [17,18]. Warm acupuncture (WA) is a traditional healing technique popular in Asia, that includes heat stimulation during acupuncture application. WA reportedly improve the symptoms of allergic rhinitis in rat models by inhibiting the expression of serum immunoglobulin E (IgE), IL-1β, and TNF-α [19]. Moreover, WA can resolve arthritic injuries by reducing the expression of skeletal proteins in rats with knee osteoarthritis, and its therapeutic effects are superior to those of acupuncture and moxibustion monotherapy [20]. Of importance, WA treatment can effectively maintain cellular morphology and ultra-microstructures of the nerve root in DRG and effectively inhibit the release of inflammatory factors nitric oxide synthase (NOS) and calcitonin gene-related peptide [21]. We previously reported that WA applied at “Piriform Two Points” can alleviate pain in patients with LDH [22,23]. However, the biological mechanism underlying the therapeutic effect of WA in LDH when applied at “Piriform Two Points” remains unclear. Therefore, this study aimed to provide a theoretical basis for clinical application of WA by exploring its therapeutic effects and the underlying mechanisms in rats with LDH induced by autologous NP transplantation.

Our study showed that WA significantly increased the paw withdrawal threshold (PWT) in non-compressive rats with LDH, reduced the levels of serum inflammatory factors, inhibited DRG inflammation factor related proteins (IL-1β, IL-6, and TNF-α), inhibited the p38MAPK/NF-κB signaling pathway related proteins (P-p38 MAPK, P-IκBα, and NF-κB), and improved the DRG morphology. Our results suggest that WA alleviates pain and inhibits inflammatory response in rats with non-compressive LDH likely by inhibiting the p38MAPK/NF-κB signaling pathway.

1. Animal experiments

The experimental protocol in this study was reviewed and approved by the medical and experimental animal ethics committee of Yunnan University of Chinese Medicine (No: R-06201968).

Sixty-nine male Sprague-Dawley rats (body weight, 200-220 g; age, 8 weeks) were purchased from the Hunan Silaike Jingda Laboratory Animal Co., Ltd. All rats were housed in the pathogen-free grade Experimental Animal Center at the Yunnan University of Chinese Medicine and maintained under a 12/12 h light/dark cycle at a constant temperature (23 ± 1℃) and relative humidity (60% ± 5%) with free access to food and water. All rats were allowed to acclimatize to the environment for 1 week before experiment.

The rat model for non-compressive LDH was established as follows. All surgical procedures were performed in a sterile environment. Rats were anesthetized using an intraperitoneal injection of 1.5% sodium pentobarbital at a dose of 30 mg/kg. The tails of anesthetized rats were cut at 1 cm from the base of the tail and the wound was sutured. The caudal discs of the rats were stripped to obtain the NP. The 5 NP samples were homogenized with 50 μL normal saline to obtain NP suspensions. The hairs from the tail vertebra to the lumbar vertebrae of the anesthetized rats were shaved, and the affected skin was disinfected.

Rats were placed in the prone position, and the no. 9 lumbar puncture needle (JM1168-016904, China) was used for epidural puncture at the L4-L5 spinous process space. After a successful puncture, 50 μL of rat autologous NP suspension was injected, followed by a 25 μL injection of 2% lidocaine into the epidural space. The success criteria for the non-compressive LDH rat model were obtained from our previous study [24].

Sixty-nine male rats were randomly divided into 5 groups using a random number table method, including a normal control group (control, n = 12), a sham-operated group (sham, n = 12), and the treatment group including the remaining non-compressive LDH rats. The success rate of the model was 80%. Thirty-six rats with LDH were divided into 3 groups (n = 12 per group): model group, electroacupuncture (EA) treatment group, and WA treatment group using a random number table. The rats in the sham group were punctured but not injected with autologous NP. The experimental protocol is shown in Fig. 1. Acupuncture needles (diameter, 0.25 mm; length, 25 mm; Cloud & Dragon, China) were used for WA and EA treatment, with an acupuncture depth of 5-7 mm. Both EA and WA were achieved by performing acupuncture at “Piriform Two Points” of “piriform 1” and “piriform 2”. The selection of the location of the “Piriform Two Points” was based on the rat acupoint map and anatomy [22,25]. “Piriformis 1” is located at the end of the rat piriformis near the sacrum, which is 5 mm immediately above the Zhibian (BL 54) point of the rat. “Piriformis 2” is located at the end of the piriformis muscle near the greater trochanter of the femur, which is 2.5 mm immediately above the Huantiao (GB 30) point.

Figure 1. Experiment protocol. EA = electroacupuncture; NP = nucleus pulposus; PWT = paw withdrawal threshold; WA = warm acupuncture.

Acupuncture at the Huantiao (GB 30) acupoint benefits the waist and legs, unblocking meridians, and is often the preferred acupoint for symptoms such as sciatica, lower limb paralysis, and hemiplegia, particularly in patients with sciatica. Acupuncture at Zhibian (BL 54) is commonly performed to treat sciatica, acute lumbar sprain, piriformis syndrome, and so forth.

The needle handle in the EA treatment group was connected to an electro-acupuncture instrument (SDZ-II, China), and the intervention conditions were continuous wave, frequency of 2 Hz, intensity of 2 mA, a single intervention for 30 min, and once per day. In the WA treatment group, the needle handle (40℃) was connected to moxa sticks with interventions for 30 mins once a day. All groups of rats were continuously treated for 7 days.

2. Assessment of pain-related behavior

Thermal hyperalgesia in rat hind limbs was measured using an intelligent hot plate instrument (JZ-BME-410C, China). All rats were acclimatized to the environment for 1 h before the behavior test. As previously described [26], the hind feet of rats were exposed to thermal stimulation at (55 ± 5℃), and the time to pain response to thermal stimulation, called pain threshold latency, was recorded. Three tests at 15-min intervals were conducted on each hind paw to obtain the mean values. Three tests at 1 h intervals were conducted on each hind paw to obtain the mean. The paw withdrawal threshold (PWT) was evaluated 1 day before surgery (day –3), 2 days before the surgery (day –1), day 1 (first day of intervention), day 3, day 5, and day 7 (end of intervention).

3. Measurement of serum cytokine levels

Serum nitric oxide (NO) levels were measured using commercially available kits following the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Serum IL-6 and prostaglandin E2 (PEG2) levels were measured using an enzyme linked immunosorbent assay (ELISA) kit following the manufacturer’s protocol (MultiSciences, China). Serum matrix metalloproteinase-3 (MMP-3), neuropeptide Y (NP-Y), and substance P (SP) levels were measured using an ELISA kit according to the manufacturer’s protocol (Meimian, China).

4. H&E staining of the DRG

DRG tissue pathology was assessed by H&E staining. The DRG was fixed in neutral buffered formalin. Then, it was dehydrated with an ethanol gradient, embedded in paraffin, sectioned, deparaffinized, and stained with H&E. The morphology of DRG was observed using a microscope (Olympus, Japan).

5. Real-time quantitative PCR analysis

Total RNA of DRG was extracted using Trizol® Reagent (Ambion, USA) following the manufacturer’s instructions. The RNA (1 μg) was reverse transcribed into cDNA using the Revert Aid First Stand cDNA Synthesis Kit (Thermo Scientific, USA). Real-time quantitative PCR (qRT PCR) was performed using Power SYBR® Green PCR Master Mix (Thermo Scientific). Gene expression was determined using the StepOne Real-Time PCR System (Applied Biosystems, USA). Results of gene expression were normalized to the mRNA expression of Gapdh. The primer sequences of rat genes were obtained from the report by Jiang et al. [27] and are summarized in Table 1.

Table 1

Primer sequences of genes in this study.

Target gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
Il-1β	GCTTCCCCGACTGGTACATC	TGATCCACGTTCTGCTCTGG
Il-6	TCCTCTCCGCAAGAGACTTC	CTCCGGACTTGTGAGGTAGG
Tnf-α	CAAGGACGGAGAGGGGAAAC	AGAAAGTCTTGCCACCCTCG
Gapdh	TTCTGGGATACACGGAGCAC	TACCAGCACCAGCGTCAAAG

6. Western blot analysis

The DRG homogenates were dissolved in RIPA lysis buffer, protease inhibitor, and phosphatase inhibitor for protein extraction. The concentration of protein samples was estimated using the BCA protein kit (Beyotime, China). Protein samples (10 μg/lane) were separated using gel electrophoresis (SDS-PAGE) and transferred onto a PVDF membrane. PVDF membranes were blocked for 1 h at room temperature and incubated with primary antibodies overnight at 4℃ and their sources were as follows: IL-1β antibody (1:1000, ab283818, Abcam), IL-6 antibody (1:1000, ab259341, Abcam), TNF-α antibody (1:1000, ab205587, Abcam), phospho-p38 MAPK (Thr180/Tyr182; 1:1000, 2859S, Cell Signaling Technology), p38 MAPK antibody (1:2000, 14064-1-AP, Proteintech), IκBα antibody (1:2000, ab76429, Abcam), p-IκBα antibody (1:1000, 2859S, Cell Signaling Technology), NF-κB p65 antibody (1:2000, ab16502, Abcam), β-actin antibody (1:10000, 66009-1-Ig, Proteintech), and β-tubulin antibody (1:2000, 10094-1-AP, Proteintech). The membranes were then incubated with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Finally, protein bands were visualized using the ECL kit (EMD Millipore). The band was quantified using Image J software.

7. Statistical analysis

SPSS 20.0 software was used for statistical analyses. All data were expressed as means ± standard errors of mean (SEM). Statistical significance was tested with one-way ANOVA followed by Tukey multiple comparison test. p < 0.05 was considered statistically significant.

1. WA alleviated pain

To evaluate the effect of WA on pain in rats with LDH induced by NP transplantation, we measured PWT of rats in each group at different time periods (day –3, day –1, day 1, day 3, day 5, and day 7). We observed no significant difference in the PWT between groups in rats before surgery, which is in line with previous reports [26,28]. After NP transplantation, the PWT in the treatment groups rats significantly reduced compared to that in the control and sham groups (p < 0.01). On day 5 of intervention, compared with the model group, the PWT in the WA group increased significantly (p < 0.05). Furthermore, on day 7 of intervention, the PWT in the EA and WA groups were significantly higher than in the model group (p < 0.05 or p < 0.01). The aforementioned results indicate that WA alleviates pain in rats with LDH induced by NP transplantation (Fig. 2 and Supplementary Table 1).

Figure 2. WA increased PWT in rats with lumbar disc herniation induced by NP transplantation. EA = electroacupuncture; NP = nucleus pulposus; PWT = paw withdrawal threshold; WA = warm acupuncture. All data are presented as means ± SEM (n = 12). *p < 0.05, **p < 0.01 vs. model group rats.

2. WA reduced the levels of serum inflammatory factors

To evaluate the effect of WA on inflammation and pain in rats with LDH induced by NP transplantation, we measured the serum levels of IL-6, PEG2, NO, SP, NP-Y, and MMP3. Our results showed that compared with the control group, the serum levels of IL-6, PEG2, NO, SP, NP-Y, and MMP3 in the model group were significantly higher (p < 0.01); however, the levels in the sham group did not differ significantly (p > 0.05). Of importance, compared with the model group, the levels of IL-6, PEG2, NO, SP, NP-Y, and MMP3 in the serum of rats in the EA and WA groups were significantly lower (p < 0.05 or p < 0.01). These results indicate that WA can alleviate pain and inflammation in rats with LDH induced by NP transplantation (Fig. 3 and Supplementary Table 2).

Figure 3. WA reduced the level of serum inflammatory factors in rats with lumbar disc herniation induced by NP transplantation. (A) IL-6; (B) PEG2; (C) NO; (D) SP; (E) NP-Y; (F) MMP3. EA = electroacupuncture; WA = warm acupuncture. All data are presented as means ± SEM (n = 12). *p < 0.05, **p < 0.01 vs. model group rats.

3. WA inhibited DRG inflammation and improved DRG morphology

We assessed the pathological changes in rat DRG using H&E staining. The results showed that the DRG structure in the control and sham groups were intact with clear nucleoli, and Nissl bodies were relatively evenly distributed in the cytoplasm. However, the cells in the DRG of the model group shrank, with an unclearly visualized nuclear membrane, faint or invisible nucleolus staining, and fewer Nissl bodies. Compared with the model group, the DRG of rats in the EA and WA groups had significantly better histopathological characteristics. The nuclear membrane was clearly visualized, the Nissl bodies in the cytoplasm were relatively evenly distributed, and the nucleoli were also visible.

In addition, we also analyzed the protein and gene expressions of the inflammatory factors IL-1β, IL-6, and TNF-α in rat DRG. The results showed that compared with the sham group, the model group had significantly higher protein and gene expression levels of IL-1β, IL-6 and TNF-α (p < 0.01) (Fig. 4 and Supplementary Table 3). However, the protein and gene expression of IL-1β, IL-6, and TNF-α in the DRG in the EA and WA treatment groups were significantly lower than those in the model group (p < 0.05 or p > 0.01) (Fig. 4 and Supplementary Table 4).

Figure 4. WA inhibited DRG inflammation and improved DRG morphology in rats with lumbar disc herniation induced by NP transplantation. (A) H&E staining of DRG (20× magnification; scale bar = 100 μm). (B) Western blot of IL-1β, IL-6, and TNF-α. (C) Relative expression of IL-1β protein. (D) Relative expression of IL-6 protein. (E) Relative expression of TNF-α protein. (F) Relative expression of IL-1β mRNA. (G) Relative expression of IL-6 mRNA. (H) Relative expression of TNF-α mRNA. EA = electroacupuncture; WA = warm acupuncture. All data are presented as means ± SEM (n = 3). *p < 0.05, **p < 0.01 vs. model group rats.

4. WA inhibited p38MAPK/NF-κB signaling pathway in the DRG

Based on the aforementioned results, we evaluated the expression levels of proteins associated with the p38MAPK and NF-κB signal pathway. The results showed that compared with the sham group, the expressions of P-p38MAPK, P-IκB, and NF-κB p65 proteins in the DRG of the model group increased significantly. Compared with the model group, the expression of P-p38MAPK, P-IκB, and NF-κB p65 proteins in the DRG in the EA and WA treatment groups significantly reduced. These results indicate that the analgesic and anti-inflammatory effects of WA in rats with LDH caused by autologous NP transplantation are likely effected by its the regulation of the p38MAPK/NF-κB signaling pathway (Fig. 5 and Supplementary Table 5).

Figure 5. WA inhibited p38MAPK/NF-κB signaling pathway of dorsal root ganglion in rats with lumbar disc herniation induced by NP transplantation. (A) Western blot of P-p38MAPK, p38MAPK, P-IκB, IκB, NF-κB p65, β-tubulin (B) Relative expression of NF-κB p65 protein; (C) Relative expression of P-p38MAPK protein; (D) Relative expression of p38MAPK protein; (E) Relative expression ratio of P-p38MAPK and p38MAPK protein; (F) Relative expression of P-IκB protein; (G) Relative expression of IκB protein; (H) Relative expression ratio of P-IκB and IκB protein. EA = electroacupuncture; WA = warm acupuncture. All the data are presented as the means ± SEM (n = 3). *p < 0.05, **p < 0.01 vs. model group rats.

LDH is reportedly the main cause of sciatic nerve pain and femoral nerve and low back pain. The pathogenesis of LDH is complex. According to current understanding, its pathogenesis is mainly associated with chemical stimulation or compression of the nerve tail at the root of the nerve that results in exacerbated inflammatory response and degeneration in the intervertebral disc and myelin sheath, which in turn causes mechanical oppression [6]. In clinical practice, most patients can be treated non-surgically [26]. Non-surgical treatment such as acupuncture and medication are the preferred choices for this type of pathology. In this study, we successfully established a rat model of non-compressive LDH by transplanting autologous NP into the epidural nerve root to observe the therapeutic effect of WA on rats with non-compressive LDH and explore the potential molecular mechanisms underlying the therapeutic effect.

The results of the behavioral assessment demonstrated that EA and WA significantly enhanced the pain threshold of rats, which indicates that EA and WA can alleviate pain in rats. In this study, WA yielded superior effects than EA, which is likely because of the superior therapeutic effect of the combination of acupuncture and moxibustion than that of acupuncture and mild electrical stimulation. After NP transplantation, the PWT in rats with LDH significantly decreased compared to that in rats in the control and sham groups. However, PWT did not differ significantly between the control and sham groups, indicating that surgery did not affect the experimental results.

As a potential autologous antigen, NP can cause intense inflammation in the central and peripheral nervous systems that causes a rapid release of inflammatory cytokines after injury, which results in nerve injury and neuronal sensitivity [29]. IL-1β and IL-6 promote hematopoiesis and enhance immunity, delay bone destruction, increase the infiltration of synovitis cells, and regulate inflammation in LDH by upregulating the expression of pro-inflammatory factors [30]. Moreover, as an important inflammatory factor, TNF-α promotes the rapid development of sensitization of nociceptive dorsal horn neurons induced by application of NP to L5 DRG in rats [31]. IL-1β enhances the biological activity of MMP-3 and inhibits the synthesis of protein polysaccharides in the disc. TNF-α promotes MMP-3 secretion in joint cartilage, inhibits the expression of collagen II and aggrecan, and promotes the degeneration and necrosis of chondrocytes [3]. Therefore, we measured the expression of IL-1 β, IL-6, and TNF-α mRNA and protein in the DRG of rats. Our results showed that WA significantly reduced the mRNA and protein levels of IL-1β, IL-6, and TNF-α in DRG. In addition, WA significantly reduced the serum levels of IL-6 and MMP-3, which is in line with previous observations [32].

Prostaglandins are considered key factors in inflammation onset, and PGE2 has the most potent pro-inflammatory effect [33]. PGE2 may be the most important factor in the occurrence of low back pain and sciatica as PGE2 can directly damage relevant nerve tissues and act on pain-related factors such as PG receptor and SP, to increase pain sensitivity of local tissues and decrease the pain threshold [34]. Of importance, NP-Y has been implicated in pain modulation and is substantially upregulated in DRG after peripheral nerve injury [35,36]. After peripheral nerve injury, NP-Y, via its Y1 receptor, plays an important role in cell survival and in transport and synthesis of the excitatory dorsal horn messengers calcitonin gene-related peptide and SP and thus may contribute to pain hypersensitivity [36]. Studies show that NO is a neurobiological component related to neuropathic pain, which is synthesized by nitric oxide synthase (nNOS) from L-arginine and oxygen [37]. In this study, we demonstrated that WA significantly reduced PGE2, SP, NP-Y, and NO levels. These results suggest that WA can reduce inflammation and pain in rats with LDH induced by NP transplantation. Therefore, we hypothesize that the decrease in proinflammatory cytokine levels after WA treatment was critical to the marked resolution of thermal hyperalgesia in LDH.

The p38MAPK signaling pathway can transmit a variety of cell signaling molecules, is the center and junction of many cell signal transmissions, and participates in various intracellular transmission processes such as inflammation, pain, apoptosis, proliferation, and differentiation [38,39]. The activation of p38MAPK signaling pathway in the DRG is key for inflammatory response and neuropathic pain in DRG, which is one of the mechanisms underlying neuropathic pain in the herniated disc [6]. Studies have shown that p38MAPK plays a critical role in the development of LDH by regulating the expression of IL-1β, IL-6, and TNF-α [40]. In rats with LDH induced by NP transplantation, the p38MAPK inhibitor SB203580 significantly reduced the levels of inflammatory cytokines IL-1β, IL-6, and TNF-α, and reduced pain in rats with LDH [40]. Moreover, SB203580 downregulates the expression of NF-κB and inhibits the release of IL-6 and TNF-α, thereby alleviating postoperative pain in rats with spared nerve injury [41]. Intervertebral disc degeneration is associated with the activation of the NF-κB signaling pathway, which is a therapeutic target for alleviating degenerative disc diseases [42]. In this study, we found that WA can inhibit the expression of P-p38MAPK, P-IκB, and NF-κB p65 proteins in rat DRG, indicating that WA can alleviate inflammation and pain in rats with LDH by inhibiting the p38MAPK/NF-κB signaling pathway.

This study has limitations. The sample size was small, which may limit the generalizability of our results. A future study with a larger sample size is needed to confirm the mechanisms through which WA improves pain and inflammation. In addition, in our future work, we will investigate the mechanisms by which WA improves pain and inflammation in human patients.

Our study shows that WA treatment minimizes pain and inhibits inflammatory factors in rats with LDH induced by autologous NP transplantation. These therapeutic effects are likely associated with the inhibition of the p38MAPK/NF-κB signaling pathway effected by WA. Our findings provide novel evidence for the effects of WA therapy on neuropathic pain induced by LDH and provide theoretical evidence for its clinical application.

Supplementary data to this article can be found online at https://doi.org/10.51507/j.jams.2024.17.1.28.

This work was supported by the 2017 Yunnan Provincial Department of Science and Technology - Yunnan University of traditional Chinese Medicine applied basic research joint special project - traditional Chinese medicine joint general project (No.: 2017FF117052).

Feng Pan, Yiran Huang and Zheng Liu designed experiments. Feng Pan, Feng Zeng Yanbei Cheng, Yongren Zheng, Zhihong Chen, Xiaoju Zhu, Mei Fang Yin, Feng Zeng and Zheng Liu performed experiments, analyzed all the results and participated in the revision of the manuscript. Feng Pan wrote the paper. All authors approved final version of manuscript.

The data that support the findings of this study are available from the corresponding author upon reasonable request.

The authors declare no conflict of interest.