Insomnia is a disorder that is characterized by an inability to sleep for a sufficient period or to even achieve a satisfactory quality of sleep during the availability of an optimum sleep opportunity or environment. Mental illnesses that are persistent and severe, such as anxiety and depression, can significantly increase the risk of developing insomnia [1]. Approximately one-third of the world’s population suffers from a sleep disorder [2]. Indeed, in China, the percentage of individuals suffering from various forms of sleep disorders is significantly higher (35%) than in other countries (27%) [3].

Modern neurophysiological research has identified that the active neural process of the rhythm nerve in the central nervous system of the brain may cause insomnia. Sleep and wake cycles are controlled by the biological clock in the brain, which changes alongside the circadian rhythm [4]. Clock genes are responsible for generating behavioral and physiological circadian rhythms in animals, whereby they mediate cellular and tissue-level oscillations in gene expression that govern their circadian rhythms [5]. It has been demonstrated that approximately half of the transcriptome oscillates during a 24-hour period to effectively manage vital biological functions [6]. The circadian rhythm of sleep and wakefulness acts as a manifestation of a biological clock; thus, a circadian rhythm disorder may cause insomnia [7,8]. A total of 14 clock genes have been identified in mammals that possess homologous genes also found in Drosophila melanogaster [9]. However, two genes, Clock and Bmal1, have been shown to play a significant role in maintaining sleep homeostasis [10]. The heterodimer Clock–Bmal1, which encodes the proteins Clock and Bmal1, acts as a transcriptional activator in the rhythm pacemaker. Although the circadian Clock gene is widely distributed throughout the brain, its center is located in the SCN of the hypothalamus. Melatonin (MT) was first discovered in 1959 and is widely distributed in the SCN of the hypothalamus [11]. The SCN is connected to the pineal gland through the superior cervical ganglion [12], which regulates the synthesis of MT by the pineal gland. Further, melatonin secretion is regulated by the circadian rhythm, through the suprachiasmatic nucleus, which regulates the secretion of melatonin by the pineal gland through light [13,14]. Research has shown that MT is capable of calming, hypnotizing, and regulating sleep and wakefulness [15].

A major focus of global research has been on the effective prevention and treatment of insomnia [16]. Currently, benzodiazepines (BZDs) are primarily used clinically to treat insomnia, although their long-term use will result in mental and physical dependence and may increase cognitive impairment and dementia risk [17]. In traditional Chinese medicine, Ziwuliuzhu acupuncture is often used to treat chronic insomnia. Studies have shown that Ziwuliuzhu acupuncture has a significant clinical effect on insomnia [18-20]. Ziwuliuzhu acupuncture is an alternative therapy that seeks to understand the circadian rhythms involved in human life, and its relationship to time [21]. Thus, it emphasizes the influence of time factors on the effect of acupuncture and moxibustion in accordance with the belief that the flow of Qi and blood in the meridians of the human body fluctuates up and down at different times. Therefore, the meridians are combined through Yin and Yang, the five elements, the dry branch of the day, and the flow of blood, while Yin is calculated according to the changes evoked by Yin and Yang. The Najia and Nazi methods are the main foundations of Ziwuliuzhu acupuncture [22], whereby acupuncture treatment is based on the Najia method, which relates to how Qi and blood are infused through the twelve body hours each day. Firstly, the year, month, and day when the patient was diagnosed with dry branch syndrome are calculated, and then, the law of the five elements of the meridian is applied to the openings of the five meridian points. In contrast to the Nazi method, which relies on infusions of blood and Qi into the twelve channels daily, the five elements of the acupoint treatment method are based on the reality of the disease. All kinds of point-opening methods pay attention to the decisive role of time factors in acupuncture and treatment and believe that taking points of time can obtain better curative effects. Indeed, this guiding ideology contains many similarities with the time therapy of modern times, which is based on biological rhythms. Scholars worldwide are beginning to increasingly appreciate the scientific value of this work.

1. Animals and ethics statement

For this study, we acquired 60 male Sprague Dawley (SD) rats (n = 60, 4-6 weeks old, SPF grade, 200-220 g) from Beijing Huafukang Biotechnology Co, Ltd. The animal certificate number for this study was SCXK (Jing) 20190008. All animals were watched for a week in isolation before being subjected to random experiments and had access to enough food and water. The Laboratory Animal Ethics Committee of Jinan University, which possesses the license: SCXK (Yue) 2017-0174 and the permission number: IACUC-20211229-05, provided oversight and direction for our investigations and to all experimental participants. Every operation was conducted in accordance with the China Council-approved Statute on the Administration of Laboratory Animals (November 1988).

2. Modeling and grouping

Sixty healthy, SPF, adult male SD rats were randomly divided into either the control group, model group, diazepam group, routine group, Najia group, or Nazi group (Ziwuliuzhu acupuncture contains the Najia method and Nazi method), meaning there were a total of 10 rats in each group. PCPA (DL-4-chlorophenylalanine) was intraperitoneally injected into the rats in the model group, diazepam group, routine group, Najia group, and Nazi group. The modeling method: PCPA suspension (dissolved in 0.9% sodium chloride solution at 100 mg/ml, with a dose of 450 mg/kg) was intraperitoneally injected within one hour of 9:00 a.m., on the first day of the experiment for two consecutive days. A total of 36 hours after the first injection, the insomnia model was evaluated using a pentobarbital sodium righting test.

3. Animal treatment

After completing successful modeling, the Najia and Nazi groups began the treatment. Specific acupuncture points were selected based on the acupoint pattern identified in the rats [23]. The acupoints with the most abundant Qi and blood channels were selected for the treatments through the Ziwuliuzhu Najia method. According to the treatment time (2022. 3. 14-2022. 3. 20), each acupoint was performed in order, with the bilateral Yingu (KI10) selected first, then, the bilateral Taichong (LR3), bilateral Daling (PC7), bilateral Yinbai (SP1), bilateral Jingqu (LU8), bilateral Rangu (KI2), and finally, the bilateral Taichong (LR3) (Fig. 1). According to the Ziwuliuzhu Nazi method, the original points of the heart meridian were selected: the bilateral Shenmen (HT7) (in TCM, there is an insomnia disease position in the heart, so the heart meridian acupoints were chosen) (Fig. 1). The Sanyinjiao (SP6) and Shenmen (HT7) acupoints were chosen for the routine group (Fig. 1). The rats were stimulated at the chosen acupuncture points, which corresponded anatomically to human acupoints [24]. For acupuncture treatment, following the fixation of rats, sterile acupuncture needles (0.18 mm diameter, 15 mm length) were inserted into the acupuncture points identified above to a depth of 2 millimeters, perpendicularly. Subsequently, the needles would be retained in their positions for 15 minutes, and a reinforcing–reducing method would be used every five minutes to turn each needle. The acupuncture start times were again selected for the Najia and routine groups: after successful modeling was completed, 7 consecutive days of acupuncture again began at 9:00 a.m. because, according to the Najia method, 9:00 a.m. represents the time at which the Qi and blood are most abundant in the body. For the Nazi group, after successful modeling, treatment began at 11:00 a.m. because, according to the Nazi method, 11:00 a.m. is the start time of the heart channel; thus, 7 consecutive days of acupuncture began at this selected time. Before modeling, an equal volume of 0.9% sodium chloride solution was intraperitoneally injected into the control group, continuously, for 2 days, whereas the diazepam and model groups were not treated following the modeling process. After modeling: except for 15 minutes per day, where the rats were fixed, neither the control nor model groups received any treatment. Conversely, the diazepam group received an intraperitoneal injection of diazepam within one hour of 9:00 a.m. for 7 consecutive days. During the acupuncture experiment, all rats were fixed with a unified fixing device.

Figure 1. The prone and supine positions of rats are shown in the following diagram. Rats were stimulated using specific acupuncture points. SP1 (Yinbai) was located at the medial aspect of the big toe, approximately 0.1 cun posterior to the corner of the nail. SP6 (Sanyinjiao) was located on the posterior border of the medial aspect of the tibia, 3 cun above the medial malleolus. LR3 (Taichong) was located in the depression distal to the junction of the 1st and 2nd metatarsal bones. HT7 (Shenmen) was situated in the transverse crease of the wrist of the forepaw, radially to the flexor carpi ulnaris tendon. PC7 (Daling) was at the midpoint of the transverse crease of the wrist, between the tendons of the palmaris longus and flexor carpi radialis. LU8 (Jingqu) was located in the depression between the styloid process of the radius and the radial side, 1 cun above the transverse crease of the wrist. KI2 (Rangu) was located on the medial border of the foot, inferior to the tuberosity of the navicular bone, at the junction of the red and white skin. KI10 (Yingu) was located on the medial side of the popliteal fossa between the tendons of the semitendinosus and semimembranosus. Acupoints that correspond anatomically to human acupoints were stimulated in rats.

4. Righting reflex test in rats

At 8:00 p.m. the night before modeling and after modeling (8:00 p.m. on the night of the last treatment), sodium pentobarbital was intraperitoneally injected (50 mg/ml, dissolved in 0.9% sodium chloride solution at a dose of 35 mg/kg) into the rats, then, the rats were placed vertically on the plate. If they could not turn over for the 60 s, their righting reflex was deemed to have disappeared. The time from administering the injection to the disappearance of their righting reflex was measured as sleep latency and was counted until the rats could again turn over. The sleep duration was measured as the rats being unable to continue to maintain the supine position within the 30 s and was also recorded (Fig. 2).

Figure 2. Flowchart depicting the experimental procedures.

5. Histological examination

All rats were starved and rested for 4 hours before 2% sodium was injected pentobarbital intraperitoneally as anesthesia (Fig. 2). A total of 2 ml of blood was removed from the heart (heparin anticoagulation, isolated lymphocytes for standby). The brain was also removed, on ice, and the hypothalamus, specifically, was cleaned of remaining brain tissue around the SCN area under a microscope, placed into an EP tube, numbered according to its specific experimental group, and then, stored on ice. The tissue specimens were transferred from the ice box to the –80℃ refrigerator when all brain tissues had been collected.

6. Hematoxylin and eosin staining

Following the fixation of the hypothalamus tissues, dehydration occurred, where the tissues were added to Xylene I for 20 minutes, Xylene II for 20 minutes, 100% ethanol I for 5 minutes, 100% ethanol II for 5 minutes, and 75% ethanol for 5 minutes, followed by rinsing with tap water. Hematoxylin solution was added for three to five minutes to stain each section before they were rinsed with tap water. After applying the Hematoxylin Differentiation solution, each slice was rinsed with tap water. The area should be treated with hematoxylin and Scott’s solution, and then, rinsed with tap water after becoming blue. Next, the sections are stained with eosin dye for 5 minutes after being submerged in 85% and 95% ethanol for 5 minutes each, respectively, and dehydrated as follows: Xylene I for 5 minutes; Xylene II for 5 minutes, 100 percent ethanol I for 5 minutes, 100 percent ethanol II for 5 minutes, and finally, sealed with neutral gum. The sections were observed under a microscope for examination, while pictures were captured and analyzed.

7. In situ TUNEL fluorescence staining assay

Sections of tissue from the hypothalamus were deparaffinized and rehydrated. Then, the slides were submerged in EDTA antigen retrieval buffer (pH 8.0). Circular, endogenous peroxidase-blocking, and serum-blocking were performed, by covering the target tissue with a secondary antibody and incubating for 50 minutes in the dark at room temperature. Next, the CY3-TSA solution was added and heated in a microwave. The second primary antibody was added alongside its HRP-tagged conjugate secondary antibody, then, FITC-TSA was added and the samples were again heated in the microwave. The nucleus was counterstained by DAPI solution, which was incubated with the samples in darkness for 10 minutes at room temperature. The fluorescence was spontaneously quenched and the samples were mounted onto coverslips, which were washed three times in a Rocker device for five minutes each using PBS (pH 7.4). FITC glows green at excitation wavelengths of 465-495 nm and 515-555 nm; CY3 glows red at excitation wavelengths of 510-560 nm and 590 nm. When CY5 is excited between 608 and 648 nm and emits light between 672 and 712 nm, it can be viewed as pink.

8. ELISA

Brain samples were taken from the abdominal aorta of insomniac rats to measure the amount of MT in their hypothalamus. After allowing the brain tissue to coagulate normally for 10-20 minutes, the samples were centrifuged for 20-30 minutes at 2,000-3,000 rpm, to separate the supernatant. A Rat Melatonin (MT) ELISA Kit was used to determine the rat melatonin (MT) concentration in the peripheral serum of insomniac rats. Calculation approach: a standard curve was created using the standard density as the horizontal axis and the OD values as the vertical axis.

9. RT-qPCR

The mRNA expressions of the clock genes Clock and Bmal1 were measured using real-time reverse transcriptase quantitative PCR. Total RNA was isolated from each rat’s hypothalamic SCN area using RNAiso Plus, according to the manufacturer’s instructions. The RNA concentration and purity were measured by an Ultramicro spectrophotometer, and the data were recorded. Operating on ice, the reaction mixture consisted of 5 × Hifair® II Buffer (4 μl), random primers N6 (50 μM; 1 μl), Hifair® II Enzyme Mix (2 μl), 400 ng total RNA, and RNase Free dH2O, to a total reaction volume of 20 μl. Then, the transcription reaction solution, and synthesis of cDNA were performed, according to the manufacturer’s instructions. The RT-qPCR was performed using a Real-Time PCR Detection System with a PCR reaction solution composed of reverse transcriptional production cDNA and forward primer and reverse primer, SYBR Green Master Mix. Primers were used: r-Clock-F2: GTCAGCCAACGTCTCTTCCA; r-Clock-R2: TGTCCTGAGTGAACGTGGTG; r-Bmal1-F2: TCCAGCCCACTGAACATCAC; r-Bmal1-R2: GATA GCCTGGGGTCTCCTGA; rGA PDH-F1: GCAT CCTGGGCTACACTGAG; rGAPDH-R1: CCACCACC CTGTTGCTGTAG. Following the polymerase chain reaction, the expression levels of the related genes were analyzed by the fluorescence quantitative PCR analyzer and relative standard curve. Each sample was analyzed three times and the average was recorded.

10. Statistical analysis

Statistical analysis was performed using IBM SPSS Statistics 25.0 software (V13.0, Chicago, IL, USA). The biological experimental data are presented as mean ± SD. Groups were compared using one-way ANOVA. LSD test was used for homogeneous variance, and Tamhane’s T2 test was used for uneven variance. A p-value < 0.05 was considered statistically significant. A remarkably statistical significance was considered with a p-value < 0.01.

1. Evaluation of therapeutic effect of Ziwuliuzhu acupuncture on insomnia rats

There was aggression, biting, fighting, and same-sex activity among the rats in the model group. The model group rats were active during the day and emaciated at night. In the diazepam, routine, Najia, and Nazi groups, the daily activity of the rats was decreased, with their jumping and impact movements significantly decreased, their hyperactivity and mania decreased, and their responses were more sensitive. After modeling and compared to the control group, the sleep latency of the model group was significantly prolonged (p < 0.001) (Fig. 3A), and sleep time was shortened (p < 0.001) (Fig. 3B). Compared to the model group, the sleep latency of the rats in the Nazi and Najia groups was shortened (p < 0.01) (Fig. 3A); the sleep time of rats in the Nazi group was prolonged (p < 0.05) (Fig. 3B).

Figure 3. The sleep latency(s) of the control, model, Najia, and Nazi groups after modeling. (A) The sleep times (min) of the control, model, Najia, and Nazi groups after modeling (B). Values are means ± S.D. (n = 10). **p < 0.01, ***p < 0.001 compared to the control group, ns = not significant. Post-hoc LSD test.

2. Hypothalamic neuronal pathology in insomniac rats following Ziwuliuzhu acupuncture

Compared to the control group (Fig. 4A), the morphology and structure of neurons in the model group (Fig. 4B) were seriously damaged, with fewer cell layers, disordered arrangement, uneven distribution, increased cell space, reduced number of surviving cells, shrinking cell body, pyknosis, deep-stained nuclei, and irregular shapes. Compared to the model group (Fig. 4B), the morphological and structural damage of neurons in the hypothalamic area of the Najia group (Fig. 4C) and Nazi group (Fig. 4D) were relatively reduced, where the arrangement of cells was slightly disordered, the number of surviving cells increased, and the shape was relatively regular.

Figure 4. HE staining was mainly used to observe the degree of inflammation and pathological reaction in the hypothalamic area of rats in each group (scale bar = 50 μm); (A) control group; (B) model group; (C) Najia group; (D) Nazi group.

3. Labeled TNF-α expression was reduced in hypothalamic SCN cells of insomniac rats treated with Ziwuliuzhu acupuncture

Immunofluorescent analysis of labeled TNF-α (tumor necrosis factor-α) was performed to observe the level of inflammatory factors in control, model, Najia, and Nazi groups. Compared to the control group, TNF-α positive macrophages were obviously present in the model group, while the increased expression of TNF-α in the Najia and Nazi groups was reduced. Moreover, the Ziwuliuzhu acupuncture treatment group (Najia group and Nazi group) may reduce the expression level of TNF-α and the inflammatory response in insomniac rats (Fig. 5).

Figure 5. Effect of Ziwuliuzhu acupuncture on inflammatory reaction in hypothalamic SCN cells from insomniac rats. In situ TUNEL fluorescence staining was used to analyze the inflammatory response. In the TUNEL assay, TUNEL-positive TNF-α (tumor necrosis factor-α) were stained in red (scale bar = 50 μm).

4. Ziwuliuzhu acupuncture upregulates MT content in hypothalamic regions of insomniac rats

Compared to the MT content in the control group, it was significantly decreased in the model group (p < 0.001), and the Nazi and Najia groups (p < 0.001). However, compared to the model group, the Nazi and Najia groups were increased (p < 0.001). A comparison of the treatment groups (diazepam, Nazi, Najia, and routine groups) indicated no significant difference among these groups (p > 0.05). These data are shown in Fig. 6. Values are mean ± S.D. (n = 6).

Figure 6. ELISA was conducted to determine the MT concentration levels in the hypothalamic area of insomniac rats in all groups. All data are shown as the mean ± S.D. (n = 6). The experiment was repeated three times. Statistical significance: ***p < 0.001 compared to the control group. Post-hoc LSD test.

5. Ziwuliuzhu acupuncture regulates the expression of Clock and Bmal1 mRNA in hypothalamic SCN areas of insomniac rats

Compared to the control group, the expression of Clock mRNA in the model group was decreased (p < 0.01). Compared to the model group, the expression of the diazepam group (p < 0.001), Nazi group (p < 0.05), and Najia group (p < 0.001) was increased, although the differences were not significant in the routine group (p > 0.05). Compared to the routine group, the Clock mRNA relative gene expression in the Najia group was palpably increased (p < 0.01), while it was also significantly increased in the diazepam group (p < 0.05). There was also a distinction between the two Ziwuliuzhu acupuncture groups. Moreover, compared to the Nazi group, the Clock mRNA relative gene expression in the Najia group was relatively improved, although not significantly (p > 0.05). The Bmal1 mRNA relative gene expression in each group (Fig. 7B: compared to the control group, the expression of Clock mRNA in the model group was decreased (p < 0.001), although the differences were not significant in the Najia group and the Nazi group (p > 0.05). Compared to the model group, the Clock mRNA relative gene expression of the Najia and Nazi groups was increased (p < 0.001). Compared with the Najia group, the relative gene expression of the diazepam group was decreased (p < 0.05); however, the differences were not significant in the Nazi group or the routine group (p > 0.05); post-hoc LSD test.

Figure 7. The gene expression levels of Clock (A) and Bmal1 (B) in ovarian tissues were detected using RT-qPCR and analyzed quantitatively. All data are shown as the mean ± S.D. (n = 6). Statistical significance was measured compared to the control group, ***p < 0.001, **p < 0.01, ns (p > 0.05). Compared to the model group, ***p < 0.001, *p < 0.05, ns (p > 0.05). Compared to the Najia group, ***p < 0.001, *p < 0.05. Compared to the diazepam group, *p < 0.05, post-hoc LSD test. ns = not significant.

The PCPA-induced rat model is a widely accepted model for studying insomnia owing to its short modeling time and good repeatability [25]. According to our study, the sleep latency was significantly increased in the model group, while sleep time was reduced, compared to the control group, which further demonstrates the model’s efficacy. Compared to the model group, the Najia group and Nazi group demonstrated a significant reduction in sleep latency, an increase in sleep time, and a decrease in the time required to fall asleep. These data combined further verify the sedative and hypnotic effects of Ziwuliuzhu acupuncture on insomniac rats. Indeed, Ziwuliuzhu acupuncture can reduce hypothalamic neuronal structural damage as well as reduce labeled TNF-α expression levels in hypothalamic SCN cells of insomniac rats, to alleviate the pathological product of chronic insomnia and inflammatory reactions.

Furthermore, in this study, we simultaneously characterized the mRNA expression of core circadian genes, Clock and Bmal1, as well as the content of MT throughout the hypothalamus of insomniac rats. The results suggest that Ziwuliuzhu acupuncture can increase the levels of Clock mRNA and Bmal1 mRNA in the SCN area of the hypothalamus in insomniac rats. Moreover, both acupuncture methods can increase the expression of biological clock genes as well as have therapeutic effects on rats suffering from insomnia. Clock genes and Bmal1 genes are periodically oscillating in the body, regulating the sleep cycle, along with Per genes and Cry genes [26]. Gene oscillations in the human body are a spontaneous process, and the two most critical gene oscillations are referred to as the main clock. Although the oscillation period for the spontaneous biological clock in the human body is not 24 hours, it is very close [5]. Consequently, if people are locked in a dark room without the influence of external factors, a 24-hour rhythm will no longer be maintained [27]. Thus, to correct the spontaneous rhythm, an external light environment must be considered because it plays an important role in aligning the circadian rhythm with external schedules. The secretion of MT is related to light. In addition to converting the periodic signal of light, MT can regulate the sleep rhythm, which influences the quality of sleep. In addition to the secretion of MT by the pineal gland, a large number of MT receptors are also concentrated in the SCN. MT can directly influence sleep and circadian rhythm when combined with MT1 and MT2 located in the SCN [28]. A sedative or hypnotic effect is produced by MT1 by inhibiting neuronal activity, while a circadian rhythmic effect is caused by MT2 by inducing phase changes in neurons [29]. MT is primarily responsible for regulating sleep, whereby the MT release inhibits the activity of the suprachiasmatic nucleus, thereby promoting sleep [30]. Through MT secreted by neurotransmitters and pineal glands, SCN integrates external photo periodic information into the body, resulting in a 24-hour regular alteration to the circadian rhythm. There has been evidence that insomnia is closely related to the decline in central melatonin function, including a decrease in MT secretion and a reduction in melatonin receptor expression [31]. A critical role is played by light and SCN in the circadian rhythm of the human body. Light is transmitted to the SCN through the optic nerve, which causes MT to be synthesized and released by the pineal gland. Subsequently, the MT receptor inhibits the activity of SCN ‘wake-up’ neurons, causing sleep to be induced [32]. The circadian rhythm can be reflected by MT expression [33]. Sleep is affected by the secretion of MT, as well as the rhythm of the SCN, which is regulated by MT secretion [24].

Biological clock genes and their expressed proteins, neurotransmitters, and mRNA play a regulatory role in sleep [34]. The degeneration of neurons in the central suprachiasmatic nucleus, a reduction in light exposure, or the input of external synchronous stimulation, such as the central rhythm oscillation becoming decreased or a temporary biological rhythm disorder induced by light and activity, will cause the occurrence of irregular sleep-wake rhythm disorder [35]. The oscillation periods (h) for Clock and Bmal1 were checked using MetaCycle (MC) and BioCycle (BC) on the RhythmicDB website and were found to be 22-24 h [36]. To maintain the rhythm of the clock signal, the oscillator of the biological clock uses two main feedback loops. The positive feedback loop is a heterodimer formed by the Clock and Bmal1 proteins [37]. The Clock/Bmal1 heterodimer binds to the E-box in the promoter region of the PERs and CRYs genes to promote their transcription into PERs and CRYs proteins [38], thereby maintaining the balance of the positive and negative cycles, and sustaining the rhythm of the circadian cycle [39]. The physiological and behavioral circadian rhythms in mice were found to be quickened when the mRNA levels of the exogenous clock gene were increased [40].

In the absence of further analysis, it cannot be determined whether the Najia method and the Nazi method have different mechanisms for treating insomnia. Meanwhile, more research is required to demonstrate the advantages of Ziwuliuzhu acupuncture over conventional acupuncture in the selection of points. Furthermore, other biological clock genes and their circadian rhythm and gene oscillation cycles may also cause insomnia in rats. It is recommended that future research include larger sample sizes and independent research on both the Najia method and the Nazi method, to examine and compare the effects of other biological clock genes, downstream protein regulatory mechanisms, and nuclear destruction or inhibitors of downstream neurotransmitters involved in the pathways regulated by SCN.

Overall, this study explored the mechanism of Ziwuliuzhu acupuncture on insomnia and increased the expression levels of Clock mRNA, Bmal1 mRNA, and MT content. In this experiment, the experimental phenomenon was analyzed alongside the Ziwuliuzhu mechanism, which can support the application of the clinical Ziwuliuzhu acupuncture theory by using objective laboratory data.

Assistance with the study: The research was supported by the National Natural Science Foundation of China (grant number: 8197151491), and the Natural Science Foundation of Guangdong Province, China (grant number: C03050309). Similarly, the authors sincerely thank Prof. Canghuan Zhao and Prof. Peng Qing for their meticulous guidance and help in this study.

Conceived and designed the experiments: A.H., G.X., Yi.C., P.Q., C.Z.; Performed the experiments: A.H., P.L, Z.H., Y.H., Z.Z., Yu.Z. Analyzed the data: A.H., G.X., Yi.C., Wrote the paper: A.H., Supervised the research: P.Q., C.Z.; All authors have read and agreed to the published version of the manuscript.

The authors declare no conflict of interest.